2025 info:eu-repo/semantics/conferenceProceedings https://unilib.phaidrabg.rs/o:8196 ISBN: 978-625-96407-1-6 Dervišević Milenković, Marina Buntić, Aneta Jovković, Marina Maksimović, Jelena Pavlović, Jelena Knežević, Magdalena Abstract: In the pursuit of biologically acceptable solutions for controlling pests that attack economically important crops and cause significant yield losses, it is essential to identify novel bacterial isolates that are both effective and environmentally sustainable. Such approaches contribute not only to pest management but also to the preservation of the environment and the advancement of sustainable agriculture. Bacillus thuringiensis (Bt) is a well-established entomopathogenic bacterium known for synthesizing a diverse range of insecticidal proteins, including Cyt toxins. These toxins become active in the insect midgut, although their precise mode of action has not yet been fully elucidated. To explore potential biocontrol strategies against wireworms (Agriotes lineatus larvae), this study aimed to detect the presence of the cyt2 gene in soilderived Bt isolates previously shown to exhibit insecticidal activity against wireworms in in vitro assays. The working hypothesis was that the presence of the cyt2 gene may be associated with the observed larvicidal effects. Six Bt isolates were screened for the cyt2 gene using conventional PCR with specific DNA primers: cyt2gral-F (ATTACAAATTGCAAATGGTATTCC) and cyt2gral-R (TTTCAACATCCACAGTAATTTCAAATGC). PCR amplification yielded products of the expected length (355 bp), which were confirmed via agarose gel electrophoresis. Among the tested isolates, only BHC2.4—previously shown to induce over 60% mortality in A. lineatus larvae—tested positive for the cyt2 gene. These findings suggest a possible correlation between the presence of cyt2 gene and insecticidal activity against wireworms. Therefore, the cyt2 gene may serve as a useful molecular marker for the preliminary screening and selection of promising Bt isolates for further bioefficacy testing. application/pdf 279709 bytes eng Bacillus thuringiensis, cyt2 gene, wireworms, Agriotes lineatus, biological control, sustainable agriculture, soil bacteria, PCR screening Detection of cyt2 gene in Bacillus thuringiensis isolates with activity against wireworms All rights reserved VII. International Agricultural, Biological & Life Science Conference, İstanbul, Turkey, 07-10 September 2025